Universidade Federal de São João del-Rei
Programa de Pós-Graduação em Bioengenharia

SIMARA DA SILVA LOPES

ANÁLISE FUNCIONAL DO GENE PSTOL1 DE ARROZ E DE SEUS
HOMÓLOGOS EM MILHO E SORGO EM PLANTAS TRANSGÊNICAS DE
TABACO

SÃO JOÃO DEL REI
MINAS GERAIS ­ BRASIL
FEVEREIRO DE 2016

i

SIMARA DA SILVA LOPES

ANÁLISE FUNCIONAL DO GENE PSTOL1 DE ARROZ E DE SEUS
HOMÓLOGOS EM MILHO E SORGO EM PLANTAS TRANSGÊNICAS DE
TABACO

Dissertação submetida ao Programa de PósGraduação em Bioengenharia da Universidade
Federal de São João del Rei como parte dos
requisitos necessários para a obtenção do título
de"Magister Scientiae" (MS).

SÃO JOÃO DEL REI
MINAS GERAIS ­ BRASIL
FEVEREIRO DE 2016

ii

iii

Dedico este trabalho aos meus pais,
Norvalino e Luzia e meus irmãos
Marildo, Suely e Silvana.

iv

AGRADECIMENTOS

Agradeço primeiramente a Deus, por ter me dado forças para seguir e
me manter nos caminhos por mim escolhidos e por Ele abençoados.
Aos meus amados pais, Norvalino e Luzia, pelo incentivo silencioso e
essencial nos caminhos que escolhi trilhar e pela compreensão de muitos
períodos de ausência.
Aos meus queridos irmãos, Marildo, Suely e Silvana por compreenderem
os períodos de ausência.
Ao Julian, por me incentivar e acreditar em mim, estar ao meu lado nos
momentos decisivos e auxílios no meu trabalho.
A minha orientadora, Dra. Sylvia Morais, que acreditou no meu potencial,
pelo incentivo constante, pelos ensinamentos e paciência. Os meus mais
sinceros agradecimentos pela orientação profissional e pessoal.
A minha co-orientadora, Dra. Andrea Almeida Carneiro, pelos valiosos
ensinamentos teóricos e práticos, conselhos e sugestões. Os meus mais
sinceros agradecimentos pela orientação profissional e pessoal.
A Barbara e Patrícia, pelos auxílios e contribuições constantes, e
ensinamentos compartilhados.
Aos analistas e técnicos dos laboratórios da Embrapa Milho e Sorgo,
Ubiraci, Beatriz, Meire, Gislene e Miguel, pelos valiosos ensinamentos.
Aos colegas de trabalho, funcionários e estudantes do Núcleo de
Biologia Aplicada da Embrapa Milho e Sorgo, que indiretamente contribuíram
para o meu crescimento profissional e pessoal.
A Coordenação de Aperfeiçoamento de Pessoal de Nível Superior
(CAPES) pela concessão da bolsa de estudos.

v

LOPES, Simara da Silva (MS). Universidade Federal de São João del Rei,
Fevereiro de 2016. Título: Análise funcional do gene Pstol1 de arroz e de
seus homólogos em milho e sorgo em plantas transgênicas de tabaco.
Orientadora: Dra. Sylvia Morais de Sousa Tinoco. Co-orientadora: Dra. Andrea
Almeida Carneiro.

RESUMO
A baixa disponibilidade de P é uma das maiores limitações para a produção
agrícola em regiões tropicais. O gene Phosphorus-Starvation Tolerance1
(OsPstol1) codifica uma proteína quinase envolvida em processos que levam ao
aumento da superfície radicular, aquisição de P e produtividade de grãos em
arroz sob deficiência de P. Homólogos do OsPstol1 foram identificados em sorgo
por mapeamento associativo em dois painéis de associação de sorgo e em milho
por mapeamento de QTL. Com o objetivo de validar a função desses genes,
OsPstol1 de arroz (controle) e seus homólogos em milho (ZmPstol3.06,
ZmPstol8.02 e ZmPstol8.05_1) e sorgo (Sb07g002840, Sb03g031690 e
Sb03g006765) foram clonados sob o controle do promotor ubiquitina no vetor
pMCG1005, tendo o gene Bar como marcador de seleção. Plantas de tabaco
Petit havana foram geneticamente transformadas via Agrobacterium tumefaciens
EHA 101 e regeneradas pela seleção de calos em meio de indução de parte
aérea e enraizamento. Fragmentos do gene Bar (~400 pb) e dos genes Pstol1
(~700 pb) foram amplificados por PCR confirmando a inserção dos respectivos
genes nas plantas transformadas. Diversas plantas apresentaram uma cópia do
trangene que foi superexpresso nas plantas selecionadas. Além disso, a
superexpressão dos genes Pstol1 aumentou o crescimento vegetativo da planta
e a área de superfície radicular sob baixo P, indicando que esses genes atuam
de forma semelhante a do gene Pstol1 em plantas transgênicas de tabaco. As
plantas de tabaco transgênico com os sete cassetes de expressão serão
testadas para aumento da aquisição de P e produtividade de grãos em condições
de baixo P.

Palavras-chaves: Eficiência de P; raiz; transformação; superexpressão.

vi

LOPES, Simara da Silva (MS). Universidade Federal de São João del Rei,
Fevereiro de 2016. Título: Functional analysis of rice Phosphorus Starvation
Tolerance 1 gene and its sorghum and maize homologs in transgenic
tobacco. Orientadora: Dra. Sylvia Morais de Sousa Tinoco. Co-orientadora: Dra.
Andrea Almeida Carneiro.

ABSTRACT
Low phosphorus (P) availability in soil is a major constraint for crop production
in tropical regions. Phosphorus-Starvation Tolerance1 gene (OsPstol1) encodes
a protein kinase involved in processes that enhance root surface, P acquisition
and grain yield in rice under P deficiency. Homologs of OsPstol1 in sorghum were
identified by association mapping in two sorghum association panels and maize
by QTL mapping. Aiming to validate the function of these genes, rice OsPstol1
(control) and its maize (ZmPstol3.06, ZmPstol8.02 and ZmPstol8.05_1) and
sorghum (Sb07g002840, Sb03g031690 and Sb03g006765) homologs were
cloned downstream of ubiquitin promoter in pMCG1005 vector, using Bar gene
as a selective marker. Tobacco Petit havana plants were genetically transformed
via Agrobacterium tumefaciens EHA101 strain and regenerated from selected
callus in shooting and rooting medium. Fragments of the Bar gene (~400 bp) and
Pstol1 gene (~700 bp) were amplified by PCR confirming integration of respective
genes in the transformed plants. Several plants presented a copy of trangene,
which was overexpressed in selected plants. Moreover, overexpression of Pstol1
genes significantly enhanced vegetative plant growth and root surface area on
low P, indicating that these genes act in a similar manner to Pstol1 gene in
transgenic tobacco plants. These transgenic tobacco plants harboring the seven
different genetic cassettes are going to be tested for the enhancement of P
acquisition and grain yield under low P conditions.

Keywords: P efficiency; root; transformation; overexpression.

vii

LISTA DE FIGURAS
Figura 1 ­ Vetor binário pMCG1005 com o promotor ubiquitina no sítio de
clonagem dos fragmentos e o marcador de seleção gene Bar sob promotor
4x35S.................................................................................................................13
Figura 2 ­ Análise filogenética das proteínas quinases de arroz (OsPSTOL1), de
milho

(ZmPSTOL8.05_1,

ZmPSTOL3.06

e

ZmPSTOL8.02),

de

sorgo

(Sb07g002840, Sb03g031690 e Sb03g006765) e de tabaco (nt151610,
nt165527, nt165497, nt182684, nt167932, nt165481, nt97611, nt165496,
nt182685)...........................................................................................................21

Figura 3 - Gel de agarose para visualização da inserção do plasmídeo com as
construções de interesse em Agrobacterium tumefaciens................................22
Figura 4 ­ Processo de transformação de tabaco: discos foliares transformados,
calos em meio de seleção, desenvolvimento parte aérea, plântulas enraizando
in

vitro,

plantas

em

casa

vegetação,

plantas

em

fase

de

florescimento......................................................................................................23

Figura 5 - Fragmentos amplificados por PCR para o gene Bar das plantas de
tabaco

transformadas

e

regeneradas

com

as

construções

de

interesse............................................................................................................25

Figura 6 - Fragmentos amplificados por PCR para os genes específicos das
plantas de tabaco transformadas e regeneradas com as construções de
interesse............................................................................................................26

Figura 7 - PCR das plântulas de tabaco pMCG1005 Ev 7, OsPstol1 Ev 6,
ZmPstol3.06 Ev 1 e ZmPstol8.02 Ev 6 utilizando primers específicos para os
genes de interesse.............................................................................................30

viii

Figura 8 - Expressão do gene marcador de seleção Bar em eventos transgênicos
das

construções

pMCG1005,

OsPstol1,

ZmPstol8.05_1,

ZmPstol3.06,

ZmPstol8.02, Sb03g031690 e Sb03g006765.....................................................32

Figura 9 - Expressão dos genes Pstol1 em eventos transgênicos das construções
ZmPstol8.05_1,

ZmPstol3.06,

ZmPstol8.02,

Sb03g031690

e

Sb03g006765.....................................................................................................32

Figura 10 - Vista lateral de plântulas de tabaco crescidas em meio de cultura sob
baixo P...............................................................................................................33

Figura 11 - Vista superior de plântulas de tabaco crescidas em meio de cultura
sob baixo P.........................................................................................................34

Figura 12 - Plântulas de tabaco individuais crescidas em meio de cultura sob
baixo P...............................................................................................................34
Figura 13 ­ Comprimento radicular total (cm) e área de superfície radicular total
(cm2) de plântulas de tabaco transgênico crescidas em meio de cultura sob baixo
P

por

5,

12

e

19

e

26

dias

após

a

montagem

dos

experimentos.....................................................................................................36

ix

LISTA DE TABELAS

Tabela 1 - Sequência dos primers utilizados para confirmar a inserção do
transgene...........................................................................................................16

Tabela 2 - Sequências dos primers e sondas utilizados nos ensaios de expressão
gênica

Taqman

e

Sybr

das

plantas

transformadas

com

genes

candidatos..........................................................................................................19

Tabela

3

-

Total

de

eventos

transgênicos

para

cada

gene

candidato...........................................................................................................27

Tabela 4 - Estimativas do número de cópias do transgene por qPCR calculado
pelo 2-Ct em linhagens T0 de tabaco.................................................................28

x

SUMÁRIO

DEDICATÓRIA....................................................................................................iii
AGRADECIMENTOS..........................................................................................iv
RESUMO.............................................................................................................v
ABSTRACT.........................................................................................................vi
LISTA DE FIGURAS...........................................................................................vii
LISTA DE TABELAS...........................................................................................ix
SUMÁRIO............................................................................................................x
1. INTRODUÇÃO.................................................................................................1
1.1 FÓSFORO.....................................................................................................1
1.2 EFICIÊNCIA NA AQUISIÇÃO DE FÓSFORO...............................................2
1.3 SISTEMA RADICULAR E A AQUISIÇÃO DE FÓSFORO.............................3
1.4 PLANTAS TRANSGÊNICAS..........................................................................5
1.5 TRANSFORMAÇÃO GENÉTICA VIA Agrobacterium tumefaciens...............6
1.6 PSTOL1 (PHOSPHORUS-STARVATION TOLERANCE 1): GENE DE
EFICIÊNCIA NA AQUISIÇÃO P EM ARROZ........................................................7
1.6.1 SbPstol1.....................................................................................................9
1.6.2 ZmPstol1..................................................................................................10
2 OBJETIVO......................................................................................................11
3 MATERIAL E MÉTODOS...............................................................................12
3.1 ÁRVORE FILOGENÉTICA DE PROTEÍNAS QUINASES DE ARROZ,
MILHO, SORGO E TABACO..............................................................................12
3.2 CLONAGEM DO GENE PSTOL1 E SEUS HOMÓLOGOS EM MILHO E
SORGO..............................................................................................................12
3.3 TRANSFORMAÇÃO DE AGROBACTERIUM TUMEFACIENS COM OS
GENES CANDIDATOS......................................................................................14
3.4 TRANSFORMAÇÃO DE TABACO COM OS GENES CANDIDATOS
...........................................................................................................................14
3.5 IDENTIFICAÇÃO E CARACTERIZAÇÃO MOLECULAR DAS LINHAGENS
TRANSGÊNICAS...............................................................................................15
3.6 ESTIMATIVA DO NÚMERO DE CÓPIAS DO TRANSGENE POR qPCR.....16
3.7 TESTE DE SEGREGAÇÃO EM EVENTOS TRANSGÊNICOS....................17

xi

3.8 ANÁLISE DE EXPRESSÃO DOS TRANSGENES POR qPCR....................17
3.9 CARACTERIZAÇÃO MORFOLÓGICA DO SISTEMA RADICULAR............19
4 RESULTADOS...............................................................................................21
4.1 ÁRVORE FILOGENÉTICA DE PROTEÍNAS QUINASES DE ARROZ,
MILHO, SORGO E TABACO.............................................................................21
4.2 TRANSFORMAÇÃO DE AGROBACTERIUM TUMEFACIENS COM OS
GENES CANDIDATOS......................................................................................22
4.3 TRANSFORMAÇÃO DE TABACO COM OS GENES CANDIDATOS..........22
4.4 IDENTIFICAÇÃO E CARACTERIZAÇÃO MOLECULAR DAS LINHAGENS
TRANSGÊNICAS...............................................................................................24
4.5 ESTIMATIVA DO NÚMERO DE CÓPIAS DO TRANSGENE POR qPCR.....27
4.6 TESTE DE SEGREGAÇÃO EM EVENTOS TRANSGÊNICOS....................29
4.7 ANÁLISE DE EXPRESSÃO DOS TRANSGENES POR qPCR....................31
4.8 ANALISE MORFOLÓGICA DOS TRANSGÊNICOS...................................33
4.9 CARACTERIZAÇÃO MORFOLÓGICA DO SISTEMA RADICULAR DOS
EVENTOS TRANSGÊNICOS............................................................................35
5 DISCUSSÃO...................................................................................................37
6 CONCLUSÃO.................................................................................................42
7 REFERÊNCIAS BIBLIOGRÁFICAS...............................................................43
ANEXO 1 - SEQUÊNCIAS DOS GENES OsPstol1, HOMÓLOGOS DE MILHO
(ZmPstol8.05_1, ZmPstol3.06 e ZmPstol8.02) E DE SORGO (Sb07g002840,
Sb03g031690 e Sb03g006765).........................................................................53
ANEXO 2 ­ MEIOS DE CULTIVO.....................................................................56

1

1 INTRODUÇÃO

1.1 FÓSFORO

O fósforo (P) é um nutriente chave no crescimento e desenvolvimento
das plantas, com papel importante no metabolismo de energia, biossíntese de
ácidos nucleicos e de membranas, fotossíntese, respiração e regulação de
enzimas (Raghothama 1999). Entretanto, é o macronutriente menos acessível
em muitos ecossistemas e sua baixa disponibilidade limita o crescimento das
plantas, com impacto direto na produtividade de culturas agrícolas (Abel et al.
2002; Lynch 2011).
As plantas absorvem o P na forma de ortofosfato (Pi) H2PO4- e HPO42-,
que está presente no solo em concentrações muito baixas, de 0,1­10 µM,
consideradas subótimas para as culturas. Além de sua baixa disponibilidade no
solo, o P se torna pouco disponível para absorção pelas plantas, uma vez que
em solos ácidos pode formar complexos insolúveis com cátions, em especial
com ferro e alumínio (Vance et al. 2003). A forma de P preferencialmente
absorvida pelas plantas é H2PO4- na faixa ótima de pH de 4,5-5,0 (Raghothama
1999). O P é considerado um dos nutrientes com menor mobilidade no solo
(Raghothama 1999), com maiores concentrações nas camadas superficiais do
solo e pouca concentração nas camadas inferiores (Vance et al. 2003). O P é
transportado para as raízes por difusão, um processo lento (Rengel 2001).
Como o P é um nutriente limitante em muitos solos para o crescimento
das plantas, normalmente são aplicadas altas doses de fertilizantes fosfatados
para minimizar os impactos de sua baixa disponibilidade nas culturas, com cerca
de 90% do fosfato natural extraído destinado a fertilizantes para a agricultura. O
P é um recurso não-renovável que tem seu pico de exploração estimado para
2030, o que irá aumentar os custos de produção por ele ser finito, principalmente
em países em desenvolvimento (Vance & Chiou 2011). Nesse contexto, o
desenvolvimento de cultivares mais eficientes na aquisição e utilização de P é
necessário para viabilizar práticas agrícolas sustentáveis. Plantas eficientes para
aquisição e utilização de P reduzem a necessidade de fertilizantes fosfatos,

2

principalmente em países em desenvolvimento, evitando sua aplicação
excessiva e, consequentemente, aumentando a produtividade nesses locais
(Vance & Chiou 2011).

1.2 EFICIÊNCIA NA AQUISIÇÃO DE FÓSFORO

As plantas desenvolveram uma série de mecanismos adaptativos a
condições de baixo P para absorver quantidade suficiente desse nutriente para
suas atividades metabólicas e seu crescimento. Esses mecanismos podem ser
agrupados em duas principais categorias: eficiência de aquisição, que é
capacidade de absorver o nutriente do solo e eficiência de utilização interna, que
é a capacidade de produzir matéria orgânica por unidade de nutriente absorvido
(Rengel & Marschner 2005; Lambers et al. 2010).
A eficiência de utilização interna do P está relacionada a uma melhor
utilização do P disponível, com modificações metabólicas envolvidas nesse
processo, tais como: mobilização do P de partes senescentes da planta para
tecidos com crescimento ativo, re-utilização do fosfato a partir de vacúolos,
substituição de fosfolipídios por sulfo ou galactolipídios em membranas
(Lambers et al. 2012; Vaneklaas et al. 2012; van de Wiel et al. 2016).
Os principais mecanismos ligados à eficiência de aquisição P são
modificações de atributos morfológicos da raiz, modificações de características
químicas na rizosfera, alterações de características fisiológicas de cinética de
absorção,

alterações

em

processos

bioquímicos

e

interações

com

microrganismos, principalmente fungos micorrízicos (Marschner 1995; Lynch
1995; Ramaekers et al. 2010; Lynch & Brown 2012).
Para avaliar a importância relativa da eficiência na aquisição de P (EAQ)
e utilização interna de P (EUTIL), 28 genótipos tropicais de milho foram
cultivados em três ambientes com baixo P e dois ambientes com alto P
(Parentoni & Souza Júnior 2008). Esses autores concluíram que em condições
de campo, em solos com baixo P a EAQ foi duas vezes mais importante que a
EUTIL, e em solos com alto P foi três vezes mais importante que a EUTIL.

3

Assim genótipos de plantas eficientes na absorção de P aumentam a
exploração do solo através de uma área de superfície maior e conversão de
formas não disponíveis de nutrientes para formas disponíveis, que são
importantes adaptações para absorção de nutrientes com pouca mobilidade no
solo (Rengel & Marschner 2005).

1.3 SISTEMA RADICULAR E A AQUISIÇÃO DE FÓSFORO

As raízes desempenham uma série de funções, como captação de água
e nutrientes, ancoragem no solo, estabelecimento de interações bióticas na
rizosfera. Portanto, mudanças no sistema radicular podem afetar diretamente a
captação de água e nutrientes (Lopes-Bucio et al. 2003). Alterações no sistema
radicular de plantas adaptadas a baixa disponibilidade de P incluem maior
formação de raízes adventícias, menor diâmetro radicular, formação de raízes
mais superficiais, formação de aerênquima, raízes laterais mais dispersas, maior
biomassa, exsudação de ácidos orgânicos e fosfatases, micorrização, pelos
radiculares mais longos e densos (Lynch 2007; Lynch 2011).
A arquitetura radicular, definida como a configuração espacial do
sistema radicular ao longo do tempo, é essencial para o forrageamento da raiz
em zonas distintas do solo e para competição entre raízes da mesma planta ou
plantas vizinhas (Lynch 2007; Lynch 2011). Os principais processos que alteram
a arquitetura do sistema radicular são divisão celular do meristema da raiz
primária (células iniciais) que permite o crescimento indeterminado por adição
de novas células à raiz, formação de raízes laterais que aumentam a capacidade
de exploração do sistema radicular e formação de pelos radiculares que
aumentam a superfície total da raiz primária e das raízes laterais (Lopes-Bucio
et al. 2003).
No sistema radicular de monocotiledôneas e dicotiledôneas, a raiz
primária é a primeira raiz a ser formada, derivada do tecido meristemático
formado embrionariamente. As raízes primárias e maduras contêm tecido
meristemático no ápice, que forma o conjunto de células meristemáticas que
darão origem a outros tipos celulares da raiz (Dolan et al. 1993; Smith & Smet
2012). No entanto, a organização do tecido da raiz tem diferenças substanciais

4

entre

Arabidopsis

thaliana,

uma

dicotiledônea,

e

cereais,

que

são

monocotiledôneas. De forma geral, os tecidos das raízes dos cereais são
maiores e mais complexos. A raiz principal de cereais, como o milho e o arroz,
tem de 10 a 15 camadas de células corticais em comparação com uma única
camada de células nas raízes de Arabidopsis. Além disso, a população de
células quiescentes é muito maior em milho, 800-1220 células, em comparação
com as quatro de Arabidopsis (Hochholdinger & Zimmermann 2008; Smith &
Smet 2012).
Ao contrário da raiz primária, as raízes laterais são pós-embrionárias.
Em Arabidopsis e na maioria das dicotiledôneas, o periciclo (tecido localizado
entre o cilindro vascular central e a endoderme) é o sítio de início das raízes
laterais. Apesar das monocotiledôneas formarem raízes primária e lateral de
forma semelhante às dicotiledôneas, seu sistema radicular é mais complexo,
formando um sistema radicular "fibroso", com vários tipos de raízes ramificadas,
como as coronais, adventícias aéreas e seminais, que constituem a maior parte
do sistema radicular. As raízes adventícias, presentes em mono e em
dicotiledôneas, são pós-embrionárias e formadas na junção da raiz com parte
aérea, para explorar as camadas superiores do solo, que são ricos em P (Smith
& Smet 2012).
A arquitetura radicular difere significativamente entre monocotiledôneas
e dicotiledôneas, mas as principais características adaptativas para adquirir P
são comuns a todas as espécies de plantas vasculares (Niu et al. 2012). Em
Arabidopsis sob condições de baixo P, o sistema radicular é mais ramificado com
redução da raiz primária e aumento do comprimento e número de raízes laterais
(Lopes-Bucio et al. 2003; Pérez-Torres et al. 2008), enquanto no milho, há um
alongamento das raízes axiais (seminais e nodais) e manutenção da densidade
de raízes laterais, com alongamento destas e posterior retardo à medida que o
estresse aumenta (Mollier & Pellerin 1999). O alongamento de raízes axiais é um
comportamento exploratório, possibilitando explorar locais no solo ricos em P
(Lynch 2007). O comprimento e o número de raízes laterais variam entre
genótipos, com alguns aumentando e outros diminuindo o comprimento e o
número dessas raízes em condições de baixo P (Zhu &L ynch 2004). O sistema
radicular de tabaco (Nicotiana tabacum L. var. Petit Havana SR-1) analisado em
meio de cultura com baixo P após 28 dias de germinação, apresentou um

5

aumento na razão raiz:parte área, no comprimento total de raízes em função da
maior atividade no ápice, mas um menor número de raízes laterais em
comparação com plantas com suprimento suficiente de P (Foti et al. 2014). A
análise do sistema radicular de plântulas de tabaco (variedades K326 e Xiang
Yan No. 4) em diferentes estágios de desenvolvimento em solução nutritiva no
sistema de floating sob diferentes concentrações de P em estágios iniciais e
tardios do desenvolvimento das plântulas mostraram que sob deficiência de P
há um aumento da superfície radicular do tabaco, por meio do aumento do
comprimento, das raízes laterais e dos pelos radiculares (Zheng et al. 2013).
O controle genético da eficiência de aquisição de P é complexo e até o
momento foram descritos poucos genes envolvidos no desenvolvimento do
sistema radicular. Alguns genes envolvidos no desenvolvimento do sistema
radicular em milho e Arabidopsis são Rtcs (rootless concerning crown and
seminal roots) (Taramino et al. 2007), Rum1 (rootless with undetectable
meristems 1) (Woll et al. 2005), Tir1 (transport inhibitor response 1) e Arf19 (auxin
response factor 19) (Pérez-Torres et al. 2008).

1.4 PLANTAS TRANSGÊNICAS

Plantas transgênicas são obtidas por técnicas de engenharia genética,
por meio da modificação de seu DNA, com a introdução de uma nova
característica que não ocorre naturalmente na espécie. Um ou mais genes
podem ser inseridos artificialmente, denominado transgene, de uma espécie de
planta relacionada ou de uma espécie totalmente diferente. Os organismos
geneticamente modificados resultantes da transformação podem apresentar
características distintas, como resistência a herbicida, insetos, pragas, vírus,
melhor qualidade nutricional, dentre outras (Rani & Usha 2013).
O estudo da função biológica de genes ou conjunto de genes pode ser
realizado em plantas transgênicas. Por meio da superexpressão, é possível
analisar membros de famílias gênicas individualmente, caracterizar a função de
genes de organismos não modelos através da expressão heteróloga e identificar

6

genes que conferem tolerância ao estresse em plantas resultante da introdução
de transgenes (Abdeeva et al. 2012).
As primeiras plantas transgênicas foram reportadas em 1983 (Fraley et
al. 1983). Desde então, muitas proteínas foram expressas em plantas como
tabaco, milho, tomate, batata, banana e alfafa (Austin et al. 1994). O tabaco
(Nicotiana tabacum) e a Arabidopsis thaliana são as plantas modelos mais
comumente transformadas (Rani & Usha 2013), pois apresentam métodos de
transformação bem estabelecidos, fácil propagação e genomas bem estudados
(Koornneef & Meinke 2010). Os métodos de transformação mais usados são
biobalística e o mediado por Agrobacterium tumefaciens.

1.5 TRANSFORMAÇÃO GENÉTICA VIA Agrobacterium tumefaciens

Agrobactérias são bactérias gram-negativas do solo com estilo de vida
predominantemente saprófito (Bourras

et

al.

2015). A

Agrobacterium

tumefaciens é o agente causal da doença conhecida como galha de coroa (Smith
&Townsend 1907), caracterizada por um crescimento neoplásico no local da
infecção (Escobar & Dandekar 2003). A infecção ocorre através da
transformação genética da célula hospedeira, com a transferência de um
fragmento de DNA fita simples, o T- DNA (DNA de transferência) para o genoma
hospedeiro, onde ocorre sua integração de forma estável (Bourras et al. 2015).
A

transformação

genética

da

célula

hospedeira

leva

a

uma

reprogramação oncogênica, propiciando um ambiente favorável para o
patógeno. A capacidade que a Agrobacterium tem de transferir o T-DNA para
outros organismos é utilizada como uma ferramenta para a transformação
genética de plantas (Pacurar et al. 2011; Bourras et al. 2015), de leveduras (Piers
et al. 1996), de fungos filamentosos (Michielse et al. 2005) e de células humanas
(Kunik et al. 2001).
Naturalmente, a Agrobacterium infecta plantas dicotiledôneas. Apesar
de as monocotiledôneas não serem suas hospedeiras naturais (Binns &
Thomashow, 1988 Bourras et al. 2015), é possível transformar cevada, trigo,
triticale e milho, com uma eficiência na obtenção de plantas transgênicas

7

estáveis de 86%, 10%, 4% e 24%, respectivamente (Hensel et al. 2009). Existem
muitos trabalhos com transformação genética de plantas via Agrobacterium, com
o objetivo de torná-las mais resistentes/tolerantes a estresses bióticos e
abióticos. Por exemplo, Jung et al. (2015) superexpressaram em arroz (Oryza
sativa) o gene BrUGE1 (UDP-glucose 4-epimerase) da couve chinesa (Brassica
rapa). Esse gene codifica uma enzima com papel essencial na interconversão
dos açúcares UDP-D-glucose (UDP-Glc) e UDP-D-galactose (UDP-Gal),
envolvidas na biossíntese da parede celular. Plantas transgênicas de arroz
superexpressando o gene BrUGE1 aumentaram a tolerância ao estresse salino
e à doença causada pela infecção da bactéria Xanthomonas oryzae pv. oryzae.
Pei et al. (2012) superexpressaram em milho o gene TsVP da planta
Thellungiella halophila, responsável pela codificação da enzima vacuolar H+pirofosfatase, que mantém o pH vacuolar, proporciona energia para transporte
no tonoplasto e estimula o transporte de auxina. Linhagens de milho com o
transgene TsVP apresentaram maior crescimento radicular, maior conteúdo e
concentração de fosfato (Pi) e maior produtividade de grãos.
Um sistema repórter visual para monitorar a deficiência de P em tempo
real no tabaco foi desenvolvido por Liu et al. (2014), usando o gene Purple (Pr)
da couve-flor (Brassica oleracea var botrytis), que produz antocianina e sob
controle do promotor do gene do transportador de fosfato em arroz OsPT6.
Plantas de tabaco transgênicas superexpressando o gene Pr, sob deficiência de
P acumulam antocianina nas folhas, possibilitando o monitoramento do estresse
desse nutriente com base em cores (inspeção visual) e também pela intensidade
do espectro de reflexão do pigmento por sensoriamento remoto hiperespectral.

1.6 PSTOL1 (PHOSPHORUS-STARVATION TOLERANCE 1): GENE DE
EFICIÊNCIA NA AQUISIÇÃO P EM ARROZ

Há vários estudos descrevendo QTLs (Quantitative Trait Loci) para
características radiculares (Wissuwa & Ae 2001; Zeng et al. 2003; Hund et al.
2004; Zhu et al. 2005; Loudet et al. 2005; Ochoa et al. 2006; Liu et al. 2008;
Rutaet al. 2010), porém eles ainda são pouco utilizados como critério de seleção

8

nos programas de melhoramento, uma vez que eles possuem efeitos pequenos,
são influenciados pelo ambiente e poucos genes candidatos controlando esses
loci foram identificados.
O QTL de efeito maior para absorção de P em arroz é o Pup1
(Phosphorus uptake 1), que está associado ao aumento da superfície radicular
e a eficiência na aquisição de P em arroz (Ni et al. 1998; Wissuwa & Ae 2001;
Wissuwa et al. 1998). Em trabalhos com uma população de mapeamento
derivada de Kasalath (eficiente na aquisição de P) e Nipponbare (ineficiente).
Wissuwa et al. (2002) indicaram que Pup1 responde por cerca de 80% da
variabilidade fenotípica para características relacionadas com absorção de P em
arroz. Gamuyao et al. (2012) identificaram o gene responsável pelo loco Pup1,
Phosphorus-starvation tolerance 1 (Pstol1), que codifica uma proteína quinase
envolvida no desenvolvimento precoce do sistema radicular de arroz em
condições de baixo P, na variedade tradicional Kasalath e ausente no genoma
de referência do arroz (Nipponbare).
A superexpressão constitutiva da região codificante do gene Pstol1
(35S::Pstol1) foi feita nas variedades modernas irrigadas de arroz IR64 e
Nipponbare, que naturalmente não possuem o gene Pstol1. Análises fenotípicas
em duas regiões com solos com baixo P mostraram que alta expressão do
transgene aumentou a produtividade de grãos em mais que 60% em ambas as
variedades de arroz. O peso seco de raiz, o total de P e o peso de grãos foram
maiores em linhagens IR64 com alta expressão do transgene em comparação
com plantas não transgênicas ou com baixa expressão do trangene em
condições de baixo P. De forma semelhante o peso de grãos e o total de P foram
maiores nas linhagens transgênicas de Nipponbare em relação às plantas
controle ou com baixa expressão (Gamuyao et al. 2012).
A análise fenotípica de linhagens IR64 superexpressando o gene Pstol1
foi feita em solução nutritiva, tratamentos de baixo (10 µM) e alto P (100µM). Sob
ambos os tratamentos, o comprimento total de raiz e a área de superfície foram
significativamente maiores em plântulas transgênicas. Experimentos com
linhagens semi-isogênicas (NILs IR64 e IR74) com e sem o loco Pup1 também
foram feitos, mostrando um significativo aumento no crescimento radicular sob
alto e baixo P (Gamuyao et al. 2012).

9

Para analisar a expressão do gene Pstol1 durante o desenvolvimento
radicular, o gene repórter da -glucoronidase (GUS) foi expresso em plantas
transgênicas IR64 sob controle do promotor nativo do Pstol1. Expressão de GUS
foi detectada no meristema, onde são formadas as raízes da coroa, principais
constituintes do sistema radicular em arroz. No meristema radicular, a expressão
de GUS foi restrita aos primórdios das raízes da coroa e células do parênquima
fora do cilindro vascular periférico, padrão semelhante ao de outros genes
envolvidos no desenvolvimento radicular. Esses dados indicam que, o gene
Pstol1 é um regulador do desenvolvimento precoce e do crescimento da raiz em
arroz (Gamuyao et al. 2012).

1.6.1 SbPstol1

Utilizando ferramentas de genômica comparativa, foi realizada uma
busca por homólogos do gene OsPstol1 no genoma de sorgo (Sorghum bicolor)
por meio do mapeamento associativo utilizando dois painéis de associação de
sorgo fenotipados para absorção de P, morfologia e arquitetura do sistema
radicular em hidroponia, além da produtividade de grãos e do acúmulo de
biomassa sob condições de baixo P no Brasil e/ou Mali. Seis genes candidatos
SbPSTOL1 foram identificados codificando proteínas preditas com identidade
superior a 50% em relação ao OsPstol1 (Hufnagel et al. 2014).
A validação por mapeamento de QTL biparental foi realizada em
população de RILs proveniente de genótipos de sorgo contrastantes para
absorção de P (BR007 x SC283). QTLs para morfologia radicular foram
encontrados para os genes candidatos Sb03g006765 (diâmetro de raiz e peso
seco), Sb03g031690 (comprimento de raiz, área de superfície radicular e volume
de raízes finas) e Sb07g002840 (peso seco de raiz e diâmetro radicular). Além
disso, também houve forte associação dos genes Sb03g006765 e Sb03g031690
com características de arquitetura radicular (Hufnagel et al. 2014).
Os resultados encontrados por Hufnagel et al. (2014) sugerem que os
genes Sb03g006765, Sb03g031690 e Sb07g002840 possuem um papel mais

10

geral no sistema radicular, alterando a morfologia e a arquitetura radicular, com
ganho na produtividade em condições de baixo P.

1.6.2 ZmPstol1

Seis genes candidatos a homólogos do gene OsPstol1 de arroz foram
identificados no genoma do milho (Zea mays) (Azevedo et al. 2015). O
mapeamento de QTL em uma população de RILs proveniente de dois genótipos
contrastantes para aquisição de P (L3 x L22), com modelos para características
simples (MIM) e múltiplas (MT-MIM) permitiu a identificação de treze regiões
genômicas associadas a características de raiz, acúmulo de biomassa, teor de
P em plântulas de milho.
Quatro genes (ZmPstol3.06, ZmPstol4.05, ZmPstol8.02 e ZmPstol8.05_1)
co-localizaram com QTLs para características de raiz, acúmulo de biomassa e
teor de P e dentre eles três genes (ZmPstol3.06, ZmPstol8.02 e ZmPstol8.05_1)
foram mais expressos na raiz do que na parte aérea em condições de baixo P
(Azevedo et al. 2015). Além disso, tiveram expressão gênica maior na linhagem
parental doadora dos alelos favoráveis. A co-localização com QTLs de
morfologia radicular é uma importante evidência, uma vez que análises
fenotípicas em solução nutritiva de linhagens semi-isogênicas de arroz com e
sem o gene Pstol1, demonstraram que sob tratamentos com baixo nível de P, o
comprimento e a área de superfície radicular foram significativamente maiores
nas plantas que carregavam o Pstol1 (Gamuyao et al. 2012).

11

2 OBJETIVO

Superexpressar em tabaco os genes OsPstol1 e seus homólogos de
milho e sorgo visando verificar a funcionalidade quanto ao aumento da superfície
radicular.

12

3 MATERIAL E MÉTODOS

3.1 ÁRVORE FILOGENÉTICA DE PROTEÍNAS QUINASES DE ARROZ,
MILHO, SORGO E TABACO

Utilizando a sequência de aminoácidos do OsPstol1 (BAK26566) foram
realizadas

buscas

contra

banco

de

dados

do

genoma

de

tabaco

(http://solgenomics.net/organism/Nicotiana_tabacum/genome) usando BLASTp.
As nove proteínas preditas de tabaco com mais de 50% de identidade
foram selecionadas e alinhadas utilizando o software ClustalX versão 1.83
(Thompson et al 1997). O alinhamento incluiu as proteínas preditas do Pstol1 de
arroz, de milho (ZmPstol3.06, ZmPstol8.02 e ZmPstol8.05_1) e de sorgo
(Sb07g002840, Sb03g031690 e Sb03g006765). As sequências de aminoácidos
foram analisadas pelo método Neighbor-joining (Saitou & Nei, 1987) utilizando o
programa NEIGHBOR (PHYLIP, Phylogeny Inference Package version 3.57c;
Felsenstein 1993) e distâncias PAM (Dayhoff et al. 1978), obtidas com o
programa PRODIST (PHYLIP). O bootstrap na análise Neighbor-joining foi feita
com o programa SEQBOOT (PHYLIP). As árvores foram visualizadas com o
programa TREEVIEW (Page 1996).

3.2 CLONAGEM DO GENE PSTOL1 E DE SEUS HOMÓLOGOS EM MILHO E
SORGO

As regiões codificantes do gene Pstol1 de arroz (OsPstol1­ 975pb), dos
homólogos de milho (ZmPstol3.06 ­ 1026 pb, ZmPstol8.02 ­ 1332 pb e
ZmPstol8.05_1 ­ 1128 pb) e de sorgo (Sb07g002840 ­ 1815pb, Sb03g031690 ­
1938 pb e Sb03g006765 ­ 1821 pb) foram sintetizadas e clonadas nos sítios
AvrII e SpeI no vetor binário pMCG1005 (Iowa State University Plant
Transformation

Facility)

pela

empresa

GenScript

USA

Inc.

(http://www.genscript.com) (FIG 1). O vetor pMCG1005 tem o promotor

13

ubiquitina para regulação e expressão dos genes candidatos e o marcador de
seleção para planta é o gene Bar sob promotor 4x35S (FIG. 1). As sequências
utilizadas foram BAK26566 para arroz (Gamuyao et al. 2012), ZmPstol8.02 e
ZmPstol8.05_1 provenientes da linhagem de milho L22 e ZmPstol3.06 da
linhagem de milho L3, sequenciadas por Negri (2015) e Sb07g002840,
Sb03g031690 e Sb03g006765 que foram sintetizadas com base no genoma
referência de sorgo BTx623 (Anexo 1).

Figura 1 - Vetor binário pMCG1005 com o promotor ubiquitina no sítio de clonagem dos
fragmentos e o marcador de seleção gene Bar sob promotor 4x35S, regiões codificantes
dos genes OsPstol1, homólogos de milho (ZmPstol3.06, ZmPstol8.02 e ZmPstol8.05_1)
e de sorgo (Sb07g002840, Sb03g031690 e Sb03g006765) sintetizadas e clonadas nos
sítios AvrII e SpeI.

14

3.3 TRANSFORMAÇÃO DE AGROBACTERIUM TUMEFACIENS COM OS
GENES CANDIDATOS

A inserção do cassete de expressão em Agrobacterium tumefaciens
EHA101 (Hood et al. 1986) foi feita pela adição do vetor binário em células
eletrocompetentes via eletroporação. Posteriormente, foi colocado 1,0 mL de
meio YEP sem antibiótico e essa mistura foi incubada por 2 horas a 28 °C com
agitação, centrifugada e ressuspendida em 200 µL de meio YEP. Foram
plaqueados 50 µL dessa suspensão em meio YEP sólido com os antibióticos
canamicina, espectinomicina e clorofenicol. As placas foram incubadas a 28 °C
por três dias. Uma colônia de cada construção gênica foi isolada e incubada a
28 °C durante 18 horas em meio YEP líquido contendo antibióticos (Lin 1995). O
DNA plasmidial foi extraído por lise alcalina, de acordo com Sambrook & Russel
(2001). Foi aplicado 1,0 µL do DNA plasmidial em gel de agarose 0,8% para
confirmar a transformação.

3.4 TRANSFORMAÇÃO DE TABACO COM OS GENES CANDIDATOS

As plântulas de Nicotiana tabacum cv. Petit havana, mantidas in vitro, e
com aproximadamente 5 cm de altura foram utilizadas para a transformação via
Agrobacterium tumefaciens. As culturas de Agrobacterium contendo as
construções

gênicas

UBI::pMCG1005::NOS,

UBI::OsPstol1::NOS,

UBI::ZmPstol3.06::NOS, UBI::ZmPstol8.02::NOS, UBI::Zmpstol8.05_1::NOS,
UBI::Sb07g002840::NOS, UBI::Sb03g031690::NOS e UBI::Sb03g006765::NOS
foram colocadas em contato com discos foliares de tabaco em uma placa de
Petri, durante 1 minuto. Após serem agitados, os explantes foram transferidos
para o meio PSM (Shooting Medium ­ Anexo 2), sem antibiótico ou agente de
seleção por 48 horas a 24-26 °C em uma câmara de crescimento iluminada.
Após esse período, os explantes foram transferidos para meio PSM
suplementado com 100 mg/L tioxin. Após sete dias foram transferidos para um
novo meio PSM + antibiótico + 1 mg/L PPT (fosfinotricina) e subcultivdas a cada

15

sete dias até que calos aparecessem e ocorresse a diferenciação das folhas. As
plântulas foram isoladas (com cerca de 1 cm de comprimento) e transferidas
para meio de enraizamento PRM (Anexo 2) + antibiótico suplementado com 1
mg/L PPT. As plântulas transformadas e enraizadas foram transferidas para o
solo. Nova seleção com herbicida PPT foi feita borrifando solução de 1mg/ml
sobre as folhas das plantas em casa de vegetação. Plantas resistentes ao
herbicida permaneceram verdes, enquanto plantas sensíveis apresentaram
folhas com coloração amarelada e morreram.

3.5 IDENTIFICAÇÃO E CARACTERIZAÇÃO MOLECULAR DAS LINHAGENS
TRANSGÊNICAS

Com o intuito de verificar a inserção dos cassetes de expressão nas
linhagens transgênicas de tabaco regeneradas foram realizadas reações de
PCR utilizando 10 ng/L de DNA genômico extraído de cada linhagem usando o
método de Saghai-Maroof et al. (1984), 10 M primer direto, 10 M primer
reverso, tampão 10X, dNTP's 2,5 M, Taq DNA Polimerase Platinum Invitrogen
500 U, DMSO 20% e água ultra pura para um volume final de 20 L de reação.
As condições do ciclo no termociclador foram: 94 °C durante 2 minutos, seguido
de uma ciclagem de 35 vezes: 94 °C por 20 segundos para desnaturação da
dupla fita de DNA, 62°C por 30 segundos para anelamento dos primers e 72 °C
por 30 segundos para extensão, terminando com 72°C por 5 minutos. Para a
amplificação do DNA genômico foram utilizados um primer senso na região
promotora e um primer complementar à região codificadora do gene de interesse
(TAB. 1).

16
Tabela 1 - Sequência dos primers utilizados para confirmar a inserção do transgene.
Primers
ubi_127_F
pOsPST1_580_R
pSbPST28_540 _R
pSbPST 31_594_ R
pSbPST67_ 611_R
pZmPST1_ 606_R
pZmPST4_ 543_R
pZmPST6_ 609_R
Bar F1
Bar R1

Sequências 5' - 3'
GTGTTTAGCAAGGGCGAAAA
TCAGATGGCACAGTTTGCTC
CAGCGGGTAGGTAAGCAAGA
TTGGTAGGGCACCTCTGAAG
CACTCCACGAGAAACCCATT
TAGGTATTCGAGCCCTCTGG
GGCCAATCCAAAGTCAGAGA
CCATCCTAAAACTGCCTTCG
AGAAACCCACGTCATGCC
GTGGTTGACGATGGTGCA

Tamanho fragmento
707 pb
667 pb
721 pb
738 pb
733 pb
670 pb
736 pb
427 pb

3.6 ESTIMATIVA DO NÚMERO DE CÓPIAS DO TRANSGENE POR qPCR

O DNA genômico foi extraído de folhas jovens de linhagens transgênicas
T0 de acordo com Saghai-Maroof et al. (1984) e usado a uma concentração de
20ng/µL. As reações de PCR quantitativo foram conduzidas no equipamento
7500 Fast Real Time PCR System (Applied Biosystems, Foster City, CA)
utilizando o kit Fast SYBR® Green Master Mix (Applied Biosystems, Foster City,
CA) seguindo as recomendações do fabricante. A estimativa do número de
inserções do transgene no genoma de tabaco foi feita conforme Barros et al.
(2011) e Zhang et al. (2014). Como referência de cópia única foram usados os
primers para o gene Axi1 (SUBR et al. 2006) de tabaco e para o transgene,
primers do gene Bar (marcador de seleção no cassete de transformação,
sequências:

bar-F

5'ACAGCGACCACGCTCTTGA3'

e

bar-

R5'GCTCTACACCCACCTGCTGA3').
Inicialmente, a estimativa do número de cópias do transgene foi
calculada para amostras aleatórias de cada construção gênica utilizando a
fórmula 2Ct_reference-Ct_transgene, onde não é preciso uma linhagem calibradora com
cópia única do transgene (Zhang et al. 2014). A partir dessa análise, uma
amostra com cópia única do transgene foi selecionada como calibradora e usado
o método de Barros et al. (2011), no qual se utiliza a equação 2-Ct (Livak &
Schimittgen 2001), para quantificar níveis de expressão relativa.

17

A reação foi composta por 2,5 L de DNA genômico 20ng/µL, 5 L do
reagente Fast SYBR® Green Master Mix (Applied Biosystems, Foster City, CA),
0,6 L de cada primer e 1,3 L de água ultra pura. As condições do termociclador
foram: 95 °C por 20 segundos uma vez, seguida por 40 ciclos de 95 °C por 3
segundos e 60 °C por 30 segundos.

3.7 TESTE DE SEGREGAÇÃO EM EVENTOS TRANSGÊNICOS

Sementes de eventos transgênicos de tabaco foram germinadas em
meio MS (Murashige & Skoog 1962) sem agente de seleção. Plântulas com 2035 dias após a germinação foram usadas para extração de DNA genômico pelo
método de Saghai-Maroof et al. (1984). Reação de PCR para confirmar presença
e ausência dos genes de interesse e padrões de segregação mendeliana foi
feita, utilizando-se as mesmas condições descritas no item 2.4 e os primers TAB.
1.
A análise de segregação foi feita usando o teste de 2 em que os valores
observados foram comparados com os valores teóricos correspondentes para a
integração de uma ou mais cópias do transgene (Tizaoui & Kchouk 2012).

3.8 ANÁLISE DE EXPRESSÃO DOS TRANSGENES POR qPCR

Sementes de eventos transgênicos de tabaco foram desinfetadas com
hipoclorito de sódio 6% por 5 minutos, lavadas com água destilada e germinadas
em frascos com meio de cultura MS ½ (Murashige & Skoog ­ Anexo 2)
polimerizado com ágar Sigma, sob tratamento de baixo P (97 M de P).
O RNA total foi extraído de plântulas inteiras de tabaco (57 dias após
germinação) utilizando o kit Plant RNeasy (Qiagen), seguindo as orientações do
fabricante. A concentração do RNA foi determinada pela leitura de absorbância
a 260, 280 e 320 m e a qualidade foi verificada por eletroforese em gel de
agarose a 2%. A síntese do cDNA foi realizada utilizando-se 1 µg de RNA total,

18

previamente tratados com DNase I, utilizando o kit "High Capacity cDNA Reverse
Transcription" (Applied Biossystems, CA).
As análises de PCR quantitativo (qPCR) foram realizadas no
equipamento ABI7500 utilizando a metodologia Taqman e SYBR Green,
segundo as recomendações do fabricante. Foi utilizado um par de primers 18S
ribossomal TaqMan® (Life Technologies, Reino Unido) e um par de primers 18S
ribossomal SYBR Green como controle endógeno e primers específicos para os
genes

Bar,

OsPstol1,

ZmPstol3.06,

ZmPstol8.02,

ZmPstol8.05_1,

Sb07g002840, Sb03g031690 e Sb03g006765 (TAB. 2). A reação para o ensaio
Taqman foi composta por 2,0 L do ensaio (primer e sonda), 10 L de TaqMan®
Universal PCR Master Mix (Life Technologies, Reino Unido), 6,0 L de água ultra
pura e 2,0 L de cDNA. As condições do termociclador foram: 50 °C por 2
minutos, seguida por um aquecimento de 95 °C por 10 minutos por uma única
vez e, depois, 40 ciclos de 95°C por 15 segundos e 60 °Cpor 1 minuto. A reação
paro o ensaio com Syber Green foi composta por 2,5 L de cDNA, 5 L do
reagente Fast SYBR® Green Master Mix (Applied Biosystems, Foster City, CA),
1,0L de cada primer (exceto para primer do gene Bar, 0,6L ) e 1,3 L de água
ultra pura. As condições do termociclador foram: 95 °C por 20 segundos uma
vez, seguida por 40 ciclos de 95 °C por 3 segundos e 60 °C por 30 segundos.
A expressão gênica relativa foi calculada conforme o método 2-CT
(Livak & Schmittgen , 2001) utilizando a seguinte equação:
ER = 2 ­Ct
Onde:
ER = expressão relativa
ct = Ctgene - alvo - Ctnormalizador
Ct = "Thresholdcycle", ciclo em que a fluorescência do alvo se torna
significativamente maior que o "ruído" ("background")

19
Tabela 2 - Sequências dos primers e sondas utilizados nos ensaios de expressão gênica
Taqman e Sybr das plantas transformadas com genes candidatos.
Primers
Bar F
Bar R
OsPstol1-F
OsPstol1-R
Sb03g006765 F
Sb03g006765 R
Sb07g002840 F
Sb07g002840 R
Sb03g013690 F
Sb03g013690 R
ZmPstol8.05_1 F
ZmPstol8.05_1 R
ZmPstol8.05_1 Sonda
ZmPstol3.06 F
ZmPstol3.06 R
ZmPstol3.06 Sonda
ZmPstol8.02 F
ZmPstol8.02 R
ZmPstol8.02 Sonda

Sequências 5' - 3'
ACAGCGACCACGCTCTTGA
GCTCTACACCCACCTGCTGA
GTTTGTGGTGCATACAACTCGT
GGTTCCTCAAAAACAGAAGATG
CGCCGACGATGAACATCTC
TGGCTCTGCTGAAGACGAA
CACCAGCCTCGATTTCATACAA
AGCCGCACCGGAAGTAGAC
CGCTCCTCCTTGCTGTCTTG
TGTAATCGTCGTCGGAAGGAT
ATCAAAAAGAAAAGAAGCAGCA
AAGGATGTGAGAATGACTAGACAC
AACGGCAACAGCACCAACAATAGG
AGTATCAGCAGGACTTGTCATG
CGCCCTCTTGGATCCTTG
CAAGCAGAACCCCGTCAGTGTCA
CAGGAATTTCACTGCAACTAGACGACCA
CCGTCACCTTTGGAGTCATG
TGGTTTTCAAGGGAAGGCTAG

Ensaio usado
Sybr
Sybr
Sybr
Sybr
Sybr
Taqman

Taqman

Taqman

3.9 CARACTERIZAÇÃO MORFOLÓGICA DO SISTEMA RADICULAR

As sementes de tabaco foram germinadas em placas de Petri
convencionais com meio de cultura MS ½ sob tratamento de baixo P (97 M de
P). Após a germinação, foram selecionadas duas plântulas uniformes por placa
com três repetições que foram transferidas para placas de Petri com dimensões
de 150mm x 25mm com o mesmo meio. Os experimentos foram realizados em
câmara de crescimento com temperatura diurna média de 27 ± 3 °C, noturna de
20 ± 3 °C e fotoperíodo de 12 horas.
O sistema radicular das plântulas de tabaco foi avaliado semanalmente
em diferentes aspectos utilizando-se o escâner Epson XL 10000 equipado com
unidade de luz adicional (TPU) e os dados analisados com o software WinRhizo
v. 4.0 (Regent Systems, Quebec, Canadá), sendo quantificadas as seguintes
características radiculares, comprimento total (cm), área projetada (cm 2),

20

superfície total (cm2), média de diâmetro (mm), comprimento total por metro
cúbico de solo, (cm/m3), volume total (cm³), número de pontas, número de
intersecções, número de ramificações. Além de comprimento de raiz (C), área
de superfície (AS), área projetada (AP), volume (V) e número de pontas (P)
dividido nos seguintes diâmetros 0,0